Search results for " truffles"

showing 6 items of 6 documents

Characterization of key aroma compounds in Burgundy truffle

2021

International audience

analyse sensorielle[SDV.BIO]Life Sciences [q-bio]/Biotechnologyaroma compoundssensorial analysisBurgundy trufflesPTR-MSsensory analysis[SDV.BIO] Life Sciences [q-bio]/Biotechnology[CHIM.THEO]Chemical Sciences/Theoretical and/or physical chemistry[SDV.AEN] Life Sciences [q-bio]/Food and Nutrition[CHIM.THEO] Chemical Sciences/Theoretical and/or physical chemistrytruffles de bourgogneGC-MS[SDV.AEN]Life Sciences [q-bio]/Food and NutritionComputingMilieux_MISCELLANEOUSPTR-ToF-MS
researchProduct

New antimicrobial peptides from Tirmania pinoyi and Terfezia boudieri in the struggle against antibiotic resistance

2017

Antibiotic resistance of common pathogenic microorganisms is a topic of great concern that has finally received media attention and entered into the political agenda of world leaders. Drug-resistant bacteria are cause of thousands of deaths worldwide, then there is an urgent need for new antimicrobials, otherwise we risk losing the ability to control effectively the infectious diseases. Such emergence can be faced looking also at not usual source of antimicrobial agents, for example medicinal mushrooms. With the objective to tackle Gram-positive and Gram-negative pathogens, we focused on two edible desert truffles mushrooms Tirmania pinoyi and Terfezia boudieri as origin of new antimicrobia…

Settore BIO/03 - Botanica Ambientale E ApplicataPeptides Desert truffles antibiotic resistanceSettore BIO/19 - Microbiologia Generale
researchProduct

Antimicrobial activity of the extracts of Terfezia claveryi and Tirmania pinoyi against gram-positive and gram-negative bacteria causal agent of dise…

2017

Tomato diseases caused by virus, bacteria and fungi have been reported worldwide and caused considerable economic losses. Among all diseases, attention is paid to those caused by bacteria. In this study, the extracts of two “desert truffles” Terfezia claveryi and Tirmania pinoyi were tested against six bacterial species, causal agent of economically important tomato diseases: Pseudomonas corrugata, P. mediterranea, P. syringae pv. tomato Pectobacterium carotovorum subsp. carotovorum, Xanthomonas vesicatoria and Clavibacter michiganensis subsp. michiganansis. The extracts from both fungal species, evaluated by agar well diffusion method, showed an antimicrobial activity against all the teste…

lcsh:Computer engineering. Computer hardwareSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetalelcsh:TP155-156lcsh:TK7885-7895Chemical Engineering (all)lcsh:Chemical engineeringDesert truffles Antimicrobial activity tomato diseases
researchProduct

IN VITRO ANTIBACTERIAL ACTIVITY OF EXTRACTS FROM THE DESERT TRUFFLES TIRMANIA PINOYI AND TERFEZIA CLAVERYI AGAINST PLANT PATHOGENIC BACTERIA

2015

Investigations on Tirmania pinoyi and Terfezia claveryi, collected in winter 2013 in Northern Borders Province of Saudi Arabia, were carried out in order to test the potential in vitro antagonistic activity of their extracts against plant pathogenic bacteria. The collected desert truffles were firstly identified in laboratory according to their macro- and micro-morphological features and then characterized by molecular analysis. Total DNA extracted from truffle tissue was amplified by polymerase chain reaction targeting the Internal Transcribed Spacer (ITS) with the following primer: TS1F (CTTGGTCATTTAGAGGAAGTAA)[1] and ITS4 (TCCTCCGCTTATTGATATGC)[2]. PCR products obtained were sequenced in…

Desert truffles Antibacterial activity Plant Pathogenetic BacteriaSettore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore AGR/12 - Patologia Vegetale
researchProduct

Wild and cultivated mushrooms as a model of sustainable development

2013

The natural resources are currently overexploited and since 1992 the Conference of Rio de Janeiro has focused on sustainable development to safeguard our planet for future generations. The Fungi kingdom includes producers of goods and services for ecosystems and organisms widely used in the food industry. Besides, macrofungi are recognized as nontimber forest products and could be utilized as agents of environmental management through weed biocontrol and environmental improvement. Moreover, the cultivation of fungi, in particular truffles, can provide an important income in agroecosystems, especially in marginal areas, along with the development of new technologies to produce novel products…

0106 biological sciencesAgroecosystemmushroom cultivationFood industryEmerging technologies[SDV]Life Sciences [q-bio]novel mushroom productsMELANOSPORUMDIVERSITYtruffleWeed biocontrol environmental management mushroom cultivation novel mushroom products trufflesPlant ScienceBiology010603 evolutionary biology01 natural sciencesenvironmental managementGoods and servicesANTIFUNGALANTIOXIDANTEcosystemEcology Evolution Behavior and Systematicsweed biocontrol; environmental management; mushroom cultivation; novel mushroom products; trufflesWeed biocontrol environmental management mushroom cultivation novel mushroom prducts trufflesBLACK TRUFFLE2. Zero hungerSustainable developmentAgroforestrybusiness.industryEcologyWeed biocontrolFUNGI15. Life on landNatural resourceTUBER-AESTIVUM VITTAD.SITU CONSERVATION13. Climate actionSettore BIO/03 - Botanica Ambientale E ApplicatatrufflesBIODIVERSITYCOMMUNITIESbusinessWeed010606 plant biology & botanyPlant Biosystems - An International Journal Dealing with all Aspects of Plant Biology
researchProduct

Antimicrobial Activity of the Desert Truffles "Tirmania pinoyi" and "Terfezia claveryi" Against Human Pathogens

2015

The development of novel antimicrobials in the struggle against pathogens and antibiotic resistance is one of the most important global challenges of our time. Medicinal mushrooms represent an unlimited source of polysaccharides with nutritional, antitumoral, antibacterial and immune stimulating properties1. In recent years the traditional studies on epigeous higher Basidiomycetes have been joined by those on hypogeous fungi and in particular on the so-named “desert truffles”. Ali2 demonstrated that organic extraction of truffles of genus Tirmania and Terfezia possess antimicrobial activity with broad-spectrum effects against Gram positive, Gram negative, aerobic and anaerobic bacteria …

Settore BIO/02 - Botanica SistematicaSettore BIO/03 - Botanica Ambientale E ApplicataSettore BIO/19 - Microbiologia GeneraleDesert Truffles Antimicrobial activity Human pathogens
researchProduct